Table 1 Plasmids and primers used in this study

Plasmid or primer	Description or sequence (5’→ 3’)	Reference
Plasmid
pFI2576	2.2 kb; A cryptic plasmid isolated from Bifidobacterium longum FI10564	Moon et al., 2009
pUC19	2.7 kb; E. coli cloning vector, Apr	Sambrook and Russell, 2001
pUC19::pFI2576 rep	4.7 kb; pFI2576 replicon (~2.0 kb) PCR product was inserted into pUC19, Apr	This study
pTG262	5.6 kb; Shuttle vector, Cmr	Fernandez et al., 2009
pLuc2	8.5 kb; Shuttle vector harboring a luciferase gene (luc+), Apr, Emr	Eom et al., 2015
pTG262 (luc+)	7.4 kb; luc+ gene was inserted into pTG262, Cmr	This study
pTG262::pFI2576 rep (luc+)	9.4 kb; pFI2576 rep was inserted into pTG262 (luc+), Cmr	This study
Primer
pFI2576 rep F-1	acgcgtcgacggttgttgctccagcacc	This study
pFI2576 rep R-1	acgcgtcgacctccaatcgtccgtcga	This study

Ap^r, resistant to ampicillin, Cm^r, resistant to chloramphenicol, Em^r, resistant to erythromycin, SalI sites (-gtcgac-) are underlined in primer sequences.