Inducible spy Transcription Acts as a Sensor for Envelope Stress of Salmonella typhimurium

Wild-type (WT) parental strain, S. typhimurium 14028S, and its isogenic gene mutant strains were used. Luria–Bertani (LB) broth (Difco, USA) was used for bacterial culture. For broth culture, strains were cultured in LB broth at 37°C with shaking. To construct gene knockout mutants, the polymerase chain reaction (PCR)-mediated one-step gene mutation using the λ Red recombinase was used, as described previously (Datsenko and Wanner, 2000). baeR and cpxR deletion mutant strains were constructed using the following primer pairs: (baeR) F: 5’-aacacgccgc gcattttgat tgttgaagat gaacccaagc gtgtaggctg gagctgcttc-3’ and R: 5’-caccccgtag accgcgcgta taaatgactg ttcggcatcc catatgaata tcctccttag-3’; and (cpxR) F: 5’-gttagttgat gatgaccgag agctgacttc cctgttaaaa catatgaata tcctccttag-3’ and R: 5’-aaaccacggg tgaccgtctt tgcgttccgg cagtttgcgggtgtaggctg gagctgcttc-3’. Primer pairs, F: 5’-cgtcaatatt gtacacgcgc-3’ and R: 5’-acagaaacgt catctcacc-3’ (baeR), and F: 5’-gatgtgttgc cgtcaacgta-3’ and R: 5’-actggctgga gctcttact-3’ (cpxR) were used for PCR confirmation. Final selection of mutants was performed as described previously (Park et al., 2015).

To construct spy transcriptional fusion, we employed a promoter probe vector plasmid pFPV25, which contains a GFP reporter gene (gfp_mut3) reporter gene (gift from Raphael Valdivia) (Valdivia and Falkow, 1996). A DNA fragment containing the spy promoter region was amplified from S. typhimurium chromosomal DNA by PCR using Pfu polymerase (iNtRON Biotech., Korea) with primer pairs F: 5’-tatgagctct gctatatcat gctgttgta-3’ and R: 5’-tatggatcca ggacggctat agaattctctg-3’. The purified PCR products were digested with SacI and BamHI (NEB, USA), and then ligated with SacI/BamHI-digested pFPV25. A single clone was finally selected following DNA sequence confirmation of insert region in pFPV25. S. typhimurium harboring the spy-gfp fusion plasmid was cultured over-night and then diluted 1:1000 in fresh LB medium. The culture was grown to log phase (OD₆₀₀~ 0.4), and then cells were treated with 4% ethanol or polymyxin B (1 ug/mL) for 1 h. After washing with phosphate buffered saline, the fluorescence intensity of bacterial cells (adjusted to OD₆₀₀ = 1.0) in a black 96 well plate (SPL, Korea) was measured with excitation at 485 nm and emission at 535 nm using a DTX 880 microplate reader (Beckman Coulter, USA).

Method used for spheroplast formation was modified from a previously described strategy (Birdsell and Cota-Robles, 1967). Briefly, overnight cultures of WT S. typhimurium were diluted 1:4 into fresh LB broth and cultured to mid-log phase (OD₆₀₀~ 0.8). Cells were collected by centrifugation (5,000 rpm for 20 min at room temperature) were washed once with 10 mM Tris buffer (pH 8.0). Following centrifugation as above, the cell pellet was resuspended with 10 mM Tris buffer (pH 8.0) containing sucrose (0.5 M) and incubated for 10 min before the addition of lysozyme (200 μg/mL). The cells were incubated for 10 min, and then an equal volume of Tris buffer containing EDTA (20 mM) was added and the cells were incubated at 37°C for a further 4 h.

Salmonella cells harboring spy-gfp fusion for microscopic observation were washed once with 10 mM Tris buffer (pH 8.0) before analysis. Cell aliquots were dropped onto microscope slides and coated with 1% agarose, and then analyzed using a Zeiss Axio A1 microscope (Zeiss, Germany) with an oil-immersion 100X objective lens. Images were captured with a charge coupled device camera.

To examine changes in spy transcription in S. Typhimurium during spheroplast formation, we constructed a spy-gfp transcriptional fusion plasmid. This type of operon fusion can be useful for monitoring Spy expression because GFP protein expressed by the spy promoter remains in cytoplasm of spheroplast cells. Natural Spy protein is exclusively expressed in periplasmic space, without any membrane association, and can diffuse out of the cell when outer membrane of spheroplasts were osmotically lysed during spheroplasting (Birdsell and Cota-Robles, 1967; Hagenmaier et al., 1997). To determine whether spy transcription was induced during spheroplast formation in S. typhimurium, the morphology and fluorescence intensity of spy-gfp containing cells were examined by fluorescence microscopy. Fig. 1(A) clearly shows that WT S. Typhimurium spheroplasts were strongly fluorescent. The method used for spheroplast formation in this study essentially involves sequential exposure to high osmotic pressure induced by sucrose, peptidoglycan lysis by lysozyme, and then membrane weakening by EDTA. Of note, cells with rounded morphology were conspicuously fluorescence after all processes for spheroplast formation were completed. Given the fact that removal of cell wall can create rounded spheroplasts, spy transcription in S. typhimurium is likely triggered by changes in membrane rigidity. While E. coli can form spheroplasts without the addition of EDTA (Birdsell and Cota-Robles, 1967), we did not observe rounded spheroplasts and spy-gfp expression in the absence of EDTA. Although it is not known whether induction of spy transcription in E. coli spheroplasts requires EDTA treatment in addition to sucrose and lysozyme, our result suggests that there may be differences in the envelope architecture of two species.

Three typical envelope stress response systems have been identified in E. coli and Salmonella species (Rowley et al., 2006). The alternative sigma factor, RpoE, directs transcription of many genes involved in envelope homeostasis, and two other envelope response systems, Bae and Cpx, both comprising a membrane histidine kinase and a cognate response regulator protein, also promote transcription of specific sets of genes in response to envelope stress. To examine the roles of these systems in spy transcription, we introduced spy-gfp fusion plasmid into S. typhimurium mutants lacking rpoE, baeR, or cpxR. Fig. 1B shows effects of these mutations on spy transcription during spheroplasting. More spheroplast cells were fluorescent in rpoE mutant than in WT, whereas no fluorescent cells were detected in baeR and cpxR mutant strains. These results demonstrate that the induction of spy transcription in S. typhimurium spheroplasts requires Bae and Cpx systems, and that elimination of RpoE-derived envelope protection can increase the spheroplast population, inducing spy transcription.

Fig. 1. Induction of spy-gfp transcription during spheroplast formation in S. typhimurium.

Download Original Figure

In E. coli, spy transcription is induced by exposure to membrane-disrupting agents, including indole and ethanol (Raffa and Raivio, 2002; Srivastava et al., 2014). To examine whether spy transcription in S. typhimurium is also induced under membrane stress conditions, spy-gfp fusion-containing Salmonella were exposed to 4% ethanol or the membrane-damaging antibiotic polymyxin B. As shown in Fig. 2, S. typhimurium treated with 4% ethanol or polymyxin B showed an approximately 2- or 3-fold increase in spy transcription, respectively, compared with that of untreated cells. In microscopic analysis, the ethanol- or polymyxin B- treated cells mostly showed strong fluorescence, while untreated cells did not (data not shown). As was observed for spheroplasting, spy transcription was enhanced in rpoE mutant under both envelope stress conditions, confirming that spy transcription can be increased in the absence of the envelope protection systems. Again, mutations in baeR and cpxR abolished the induction of spy transcription in ethanol- and polymyxin B- treated S. typhimurium. As was observed in E. coli (Srivastava et al., 2014), spy transcription in S. typhimurium spheroplasts and in cells exposed to 4% ethanol required both the BaeR and CpxR regulators. Both regulators were also required for induction of spy transcription in polymyxin B-treated cells. Thus, regulatory elements for spy gene transcription appear to be conserved between the two species.

Fig. 2. Induction of spy-gfp transcription in S. typhimurium by exposure to ethanol and polymyxin B. Fluorescence intensity of S. typhimurium harboring the spy-gfp fusion was measured following treatment with 4% ethanol or polymyxin B (1 μg/mL) for 1 h. An untreated control (UT) was also included. Data shown are the means±standard deviation from three independent cultures.

Download Original Figure

In conclusion, this study has clearly demonstrated for the first time that spy transcription can be induced in S. typhimurium by exposure to envelope stresses, including ethanol, polymyxin B, and spheroplasting, and is dependent on the envelope stress response regulators BaeR and CpxR. Homology analysis showed that the spy genes are conserved amongst all serovars of S. enterica, including pathogens causing zoonosis (data not shown). Spy, which functions as a broad-spectrum chaperone, is exclusively expressed in the periplasmic space under envelope stress conditions, which are sensed by two major envelope response systems. Therefore, it is plausible that Salmonella strains harboring the spy-gfp fusion constructed in this study could be used as a whole-cell biosensor for screening the efficacy of new antimicrobials that specifically target the Salmonella cell envelope.